Growing alone in mixed hardwood/pine forest. No apparent association with wood.
Cap, ca 2 inches diameter; light tan with yellow ochre cast.
Pore surface white/translucent and darkening slightly; bruising brown.
Stipe white, showing a hint of reticulation particularly towards the apex.
Spore print, white.
Spores. Smooth, ca. 8-10µ x 2-3µ
Identification initially suggested by Davide Puddu
Growing under oaks in suburban lawn alongside B. luridellus. Dull brown cap with a faint suggestion of red in the cap’s Center. No staining. Inrolled margins. Dull yellow context that gradually turns a marbled gray-brown. Basal mycelium is white. Odor is mild, inconspicuous. Flavor is mild, with a hint of pepperiness that I may be imagining.
—
Image #5: Top-left is luridellus
—
Originally posted to Mushroom Observer on Jun. 18, 2018.
Growing under live oaks in suburban lawn.
—
Originally posted to Mushroom Observer on Oct. 1, 2018.
Growing under pines. Context flashes yellow with KOH.
—
Additional sequences:
nrLSU: GenBank ON554838.
1) Partial LSU sequence between LR0R and LR5 primers
2) DNA sequencing by Molecular Solutions, LLC (Matt Gordon)
2) Sequence editing and assembly by IGS
nrLSU sequence -- MO410311/Boletus mahoganicoloroides:
ATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAGAGCTCAAATTTCGAATCTGGCGGTCTTTGGCCGTCCGAGTTGTAATCTAGAGAAGCGTCTTCCGCGCTGGACCGTGTATAAGTCTCCTGGAAGGGAGCGTCGTAGAGGGTGAGAATCCCGTCTTTGACACGGACTGCCAGTGCTATGTGATGCGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAACGGGTGGTAAATTCCATCTAAAGCTAAATACGGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGACGTCAGTCGCGTCGCCCGGGGATCAACCTTGCTTCTCGCTGGGTGTACTTCCCGGTCGACGGGTCAGCGTCGGTTTCGGTCGCCGTACAAGGGCGAAGGGAATGTGGCACTCCTCGGAGTGTGTTATAGCCTTTCGTCGCATGCGGCGCTCGGGACCGAGGAACTCAGCACGGCTTCGGTCTGTGCTTAGGACGCTGGCATAATGGCGTTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTCGGGTGGCAAACCCGAGCGCACAATGAAAGTGAAAGTCGAGACCTCTGTCGTGGAGGGCATCGACGCCCGGACCTGAGTCTTTGACGACGGATCTGCGGTAGAGCATGCATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCGAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCTGC
—
Originally posted to Mushroom Observer on May 24, 2020.
Under water oak in suburban lawn. Cap is almost black, velvety. Bulbous stipe. Conspicuous reticulum. Stuffed pores.
—
Originally posted to Mushroom Observer on Aug. 11, 2022.
Dark (almost black, with maybe a faint suggestion of violet) pitted cap. Prominently reticulate stipe with violet undertones. No staining. Odor and taste are mild to pleasant.
Whatever it is, it’s keying out in BENA to B. separans.
—
Originally posted to Mushroom Observer on Aug. 9, 2017.
Growing solo under a suburban live oak. If this southern separans-like bolete is, in fact, distinct from the northern separans, as postulated by Igor Safonov, collections like this one suggest that distinguishing between the two on the basis of morphology is gonna be tough.
—
Originally posted to Mushroom Observer on Aug. 17, 2018.
Either separans or its southern double.
—
Originally posted to Mushroom Observer on Sep. 9, 2018.
Dark burgundy caps that, oddly, lack the dimples I’m used to seeing. Also appear to have sterile (and occasionally beveled) margins. Beautiful reticulum. Growing under oaks.
—
Originally posted to Mushroom Observer on Sep. 9, 2018.
https://mushroomobserver.org/327818
Tylopilus pseudovariobrunneus I. Safonov & Kudzma nom. prov.
Bolete, purple cap, growing near decaying palm
Found growing solitary on pine straw near pine.
Smells fresh. About the size of a human pinky. Very ornate stipe.