Tomentose, leaves are reminiscent of sagebrush, herbaceous.
Poor photo, but posting anyway as this wolf was sited only a few days after wolf reintroduction to Colorado, per news reports, and not in this county. Wolf was 200 yards from road, and within site of a herd of mule deer. Looked healthy, immediately perked ears and ran in opposite direction when it saw us.
Fluorescent in ultraviolet light, under oak and white pine.
Front Range with 5-needle pine, aspen, doug fir, Eng spruce
Found by Patrick Waldron
Growing near Pinus ponderosa and Quercus gambelii.
Albino lacking normal red coloration
Staining blue where damaged. Growing in a wet grassy area near ponderosa pine.
ITS sequence: CTTTGGCGTGGTTGTAGCTGGCCCTCTCGGGGGCATGTGCCCACTATGTCATCTTTATATCTCCACCTGTGCACCCTTTGTAGAACGTTTTTGGACTGATAGGAGTGAGACTCGCAAGAGTTGACCAAGTTGAACGTCCTGAACGGTCTACGTTTTCATATACCCCAAAGAATGTAACAGAATGTATCATATGGCCTAGTGCCTATAAACTAAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTTACCAGCTTTTGTTAGCTCGTGTAATGGCTTGGACTTGGGGGTCTTTTGCTGGCTTCGTCAAGAGGTCAACTCCCCTTAAATGCATTAGCCGGCTTCCCCGCGTGGACCGTCTATTGGTGTGATAATTATCTACGCCGTGGACAATCTGCTTTAATGGGTTGAAGCTGCTTCTAACCGTCTATTAAGTTGGACAATACATATGACAATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTTTGGCCGTCCGAAGTTGTAATCTAGAGAAGTGTTATCCGCGCTGGACCGTGTAC
200 bp match 100% with Psilocybe quebecensis in GenBank, however that sequence is short and a longer reference sequence is needed to be sure of the match.
Subalpine spruce-fir forest; on soil. Velvety cap, yellow pores bruising blue
Growing from a cut but resprouting stump of green ash, Fraxinus pennsylvanica. This is the second time this stump fruited that I know of, the first being in 2016. Will preserve a specimen to send to the Sam Mitchel Herbarium of Fungi in Denver. Hoping to get a sample sequenced as well.