AG401_Inocybe_cf_subfulva
ATTATTGAATAAACTTGAACGAGTTGATGCTGGCTCCAATAATGGGCATGTGCACACTTGTCATTTTTATCTCTCCACTTGTGCACATATTGTAGATTGATTGAGGATTGCTGTGCTTCATTTAATAAAGTCAGCTTTGCCTTGTATCCATTAGATCTATTATTTTTTTCATAACCTCTTAAATGTGTATAGAATGTTGAATTTGGGAAATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATCTTGCGCTCCTTGGTATTCTGAGGAGCATGCCTGTTTGAGTGTCATTAAAGTTCTCAACTGCATCTCTATTGATGTGGCTTGGATAGTGGGGGTTACATTTGCAGGCTTTTCCAAAAAATGAGTCTGCTCCCCTGAAATGAATTAGTGGTATCTATGCAGAGACTACTTATAGGTGTGATAACTATCTATGCCTTGGTTAGATACTGTATAAACTGCTTCT
Taste mild. I think its a Cort but not sure.
Growing in grass next to public park. Black spore print.
Spores: 11.4-12.3 × 6.9-8
No blueing noted.
Cheilocystidia in photo below. Still learning what to do with this information. (Recommendations on what stain to use would be greatly appreciated!)
—
Originally posted to Mushroom Observer on Jun. 20, 2024.
Thank you to the incredibly cool homeowner who allowed me to study the mushrooms on their lawn.
Same observation as https://www.inaturalist.org/observations/154332861
Honey, brown convex to waxy, striate cap,
White stipe,
Cortina present,
No odor,
Cleaner taste,
Indistinct KOH,
Growing in deadwood and in grass next to trail,
Mild white UV on gill margin,
Blue staining,
Dark spored,
Near alder
Brown, umbonate cap with lighter margin,
Light brown stipe,
Cortina present,
No UV,
Brown KOH,
Indistinct odor/taste,
Near willow
Need experts to chime in as this mushroom looks familiar but given age and degradation it’s hard for me to put a name to it.
Found by a member of Midwest Psilocybin Hunters Facebook group
Small stature, kind of felty cap, ellipsoid spores all lead me to believe these are psilocybe caerulipes samples have been sent for DNA to Alan Rockefeller and Stephen Russell
Psilocybe caeruleorhiza nom. prov.
Description deadline is January 15th 2024.
Found in the same original Ohio location found by Kyle Canan.
The first 4 photos after the cover are my iPhone photos.
Next to Coccoloba diversifolia in rockland hammock; solitary, sporocarp grayish, purplish drab yellow.
Blue/ green on stem base and cap
Not sure about this one .
From a culture labeled Pleurotus salmoneostramineus
HAY-F-003035
nanopore able to see parasite
fruiting on fresh sod. Fruiting body on the far left is something else, but this observation is for the others.